Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05246

HP ID(1) HP05246
Gene ID(2) 10439
Gene Symbol finder OLFM1
Protein Name olfactomedin 1
RefSeq NM_006334.3
Length of RefSeq (bp) 1212
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.522484

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb06H05 pKA1U5 GAGCCCAGCCCTGCCCAGCCCTGCCCGGAGGCAGACGCGCCGGAACCGGGACGCGATAAA
RBd50F03 pGCAP10 GcCTCCCGGCcgcGgCCCCCGCGCGCAgCCCGCgCAgCgcTCAGAGCCGGACGGcgcTTC
RBd64B02 pGCAP10 GGTTCGTGCTCCGCAGGGCGCGCCTCTCTCCGCCAATGCCAGGCGCGCGGGGGAGCCATT
RBd84C02 pGCAP10 GATGCAGAGCGGAGGCTTCGCGCAGCAGAGCCCGCGCGCCGCCCGCTCCGGGTGCTGAAT
RBd97G05 pGCAP10 GAGACGCGCCGGAACCGGGACGCGATAAATATGCAGAGCGGAGGCTTCGCGCAGCAGAGC
RBdS014F23 pGCAP10 CGGCCGGCCGATGANAGCCGGACGGCGCTTCCCGGTGGCGGCGGAGGAGCCCGGAGGGAC
RBdS105P16 pGCAP10 GAGAGCCGGACNGCGCTTCCCGGTGGCGGCGGAGGAGCCCGGAGGGACGCNGCCGGGCNA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl