Prev. | 

RIKEN DNA Bank Human Resource - OLFM1

Gene ID NCBI Gene 10439 |  KEGG hsa:10439
Gene Symbol OLFM1
Protein Name olfactomedin 1
Synonyms AMY|NOE1|NOELIN1|OlfA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011053 IRAK027K13 pCMV-SPORT6 BC015437 NM_014279 Partial
HGY082142 IRAL005F22 pOTB7 BC008763 NM_014279 Full
HGY090830 IRAL027B06 pOTB7 BC011741 NM_014279 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025218 W01A063A18 pENTR-TOPO IRAL005F22 BC008763 NM_014279  
HGE025224 W01A063A24 pENTR-TOPO IRAL005F22 BC008763 NM_014279  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322573 RBb06H05 pKA1U5 NM_006334.3  
GAGCCCAGCCCTGCCCAGCCCTGCCCGGAGGCAGACGCGCCGGAACCGGGACGCGATAAA
HKR380123 RBd50F03 pGCAP10 NM_006334.3  
GcCTCCCGGCcgcGgCCCCCGCGCGCAgCCCGCgCAgCgcTCAGAGCCGGACGGcgcTTC
HKR385626 RBd64B02 pGCAP10 NM_006334.3  
GGTTCGTGCTCCGCAGGGCGCGCCTCTCTCCGCCAATGCCAGGCGCGCGGGGGAGCCATT
HKR393650 RBd84C02 pGCAP10 NM_006334.3  
GATGCAGAGCGGAGGCTTCGCGCAGCAGAGCCCGCGCGCCGCCCGCTCCGGGTGCTGAAT
HKR398949 RBd97G05 pGCAP10 NM_006334.3  
GAGACGCGCCGGAACCGGGACGCGATAAATATGCAGAGCGGAGGCTTCGCGCAGCAGAGC
HKR405743 RBdS014F23 pGCAP10 NM_006334.3  
CGGCCGGCCGATGANAGCCGGACGGCGCTTCCCGGTGGCGGCGGAGGAGCCCGGAGGGAC
HKR442376 RBdS105P16 pGCAP10 NM_006334.3  
GAGAGCCGGACNGCGCTTCCCGGTGGCGGCGGAGGAGCCCGGAGGGACGCNGCCGGGCNA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl