Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05241

HP ID(1) HP05241
Gene ID(2) 4967
Gene Symbol finder OGDH
Protein Name oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
RefSeq NM_002541.2
Length of RefSeq (bp) 4257
Chromosome 7p14-p13
Reference DDBJ accession
UniGene Hs.488181

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92F07 pKA1U5 ATTCGGGTGGAGCTGAGCCGGAGACAGGCAGTTGTGAAAAACTTCAGGACAAAAATGTTT
RBb06D11 pKA1U5 CATTCGGGTGGAGCTGAGCCGGAGACAGGCAGTTGTGAAAAACTTCAGGACAAAAATGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl