Prev. |  KEGG KO K00164 > 

RIKEN DNA Bank Human Resource - OGDH

Gene ID NCBI Gene 4967 |  KEGG hsa:4967
Gene Symbol OGDH
Protein Name oxoglutarate dehydrogenase
Synonyms AKGDH|E1k|OGDC
Ortholog resources KEGG ortholog (KEGG orthology K00164) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083397 IRAL008I05 pOTB7 BC004964 NM_002541 Full
HGY084210 IRAL010I18 pOTB7 BC014617 NM_002541 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076927 ARe92F07 pKA1U5 NM_002541.2  
ATTCGGGTGGAGCTGAGCCGGAGACAGGCAGTTGTGAAAAACTTCAGGACAAAAATGTTT
HKR322483 RBb06D11 pKA1U5 NM_002541.2  
CATTCGGGTGGAGCTGAGCCGGAGACAGGCAGTTGTGAAAAACTTCAGGACAAAAATGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl