Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05238

HP ID(1) HP05238
Gene ID(2) 8624
Gene Symbol finder PSMG1
Protein Name proteasome (prosome, macropain) assembly chaperone 1
RefSeq NM_003720.2
Length of RefSeq (bp) 1146
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.473838

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb06C12 pKA1U5 GCCCGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTATGGCGGCCACGTTCTT
RBd05D07 pGCAP10 GCCAGCCGGTCACGGGGCGGCTATGGCGGCCACGTTCTTCGGAGAGGTGGTGAAGGCGCC
RBd23B08 pGCAP10 GAAGCCGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTAT
RBd35B08 pGCAP10 GGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTATGGCGG
RBdS083C01 pGCAP10 GAAGCCGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTAT
RBdS156P03 pGCAP10 GGTCTCGCGCAAGCCGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl