Prev. |  KEGG KO K11875 > 

RIKEN DNA Bank Human Resource - PSMG1

Gene ID NCBI Gene 8624 |  KEGG hsa:8624
Gene Symbol PSMG1
Protein Name proteasome assembly chaperone 1
Synonyms C21LRP|DSCR2|LRPC21|PAC-1|PAC1
Ortholog resources KEGG ortholog (KEGG orthology K11875) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080722 IRAL001N10 pOTB7 BC003619 NM_003720 Full
HGY080982 IRAL002H14 pOTB7 BC003619 NM_003720 Full
HGY084323 IRAL010N11 pOTB7 BC012809 NM_003720 Full
HGY089052 IRAL022K12 pOTB7 BC010424 NM_003720 Full
HGY090884 IRAL027D12 pOTB7 BC011755 NM_003720 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322460 RBb06C12 pKA1U5 NM_003720.2  
GCCCGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTATGGCGGCCACGTTCTT
HKR362079 RBd05D07 pGCAP10 NM_003720.2  
GCCAGCCGGTCACGGGGCGGCTATGGCGGCCACGTTCTTCGGAGAGGTGGTGAAGGCGCC
HKR369232 RBd23B08 pGCAP10 NM_003720.2  
GAAGCCGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTAT
HKR374032 RBd35B08 pGCAP10 NM_003720.2  
GGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTATGGCGG
HKR433249 RBdS083C01 pGCAP10 NM_003720.2  
GAAGCCGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGGGGCGGCTAT
HKR462763 RBdS156P03 pGCAP10 NM_003720.2  
GGTCTCGCGCAAGCCGGCGTGCGGTCCGGCGGCGCTGCAGTTGTGTCCAGCCGGTCACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl