Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05229

HP ID(1) HP05229
Gene ID(2) 5570
Gene Symbol finder PKIB
Protein Name protein kinase (cAMP-dependent, catalytic) inhibitor beta
RefSeq NM_181795.1
Length of RefSeq (bp) 1909
Chromosome 6q22.31
Reference DDBJ accession
UniGene Hs.719228

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085L20 pGCAP10 GGCAGAGCGCTGGGCGAGCGCGAGCGCCAGGGCACCGGCAGGGCAGGCAGCTGCGCGCGG
RBb05F11 pKA1U5 GAGACGCGGCCGCATCCCGGTGGACTGTAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCA
RBb08D02 pKA1U5 GGCAGCTCCGGGCCGCAGAGCGCTGGGCGAGCGCGAGCGCCAGGGCACCGGCAGGGCAGG
RBb72G10 pGCAP1 GAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCAGCTCCGGGCCGCAGAGCGCTGGGCGAG
RBd05D02 pGCAP10 GCTGCTCTATTCAGCAAATGTGCAAATGGATGCTGCAGGACCGTAACAGTAGACATTGAT
RBd08F07 pGCAP10 GGGTGGTTAACGCACAAGTAGGATAAAAGAGCTCGCCCCAGGCTGCCAGCAGAAAAAAGC
RBd87C10 pGCAP10 GACGTACCTGGTGGAGCGGGCGCGTGAGTGGGTGTCCCTATGCGAGGAGGGAGGAGTGGG
RBdS022H21 pGCAP10 GAGACGCGGCCGCATCCCGGTGGACTGTAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCA
RBdS104P17 pGCAP10 GAGACGCGGCCGCATCCCGGTGGACTGTAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl