Prev. | 

RIKEN DNA Bank Human Resource - PKIB

Gene ID NCBI Gene 5570 |  KEGG hsa:5570
Gene Symbol PKIB
Protein Name cAMP-dependent protein kinase inhibitor beta
Synonyms PRKACN2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096784 IRAL041P24 pDNR-LIB BC036011 NM_181795 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234284 ARiS085L20 pGCAP10 NM_181795.1  
GGCAGAGCGCTGGGCGAGCGCGAGCGCCAGGGCACCGGCAGGGCAGGCAGCTGCGCGCGG
HKR322131 RBb05F11 pKA1U5 NM_181795.1  
GAGACGCGGCCGCATCCCGGTGGACTGTAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCA
HKR323274 RBb08D02 pKA1U5 NM_181795.1  
GGCAGCTCCGGGCCGCAGAGCGCTGGGCGAGCGCGAGCGCCAGGGCACCGGCAGGGCAGG
HKR348954 RBb72G10 pGCAP1 NM_181795.1  
GAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCAGCTCCGGGCCGCAGAGCGCTGGGCGAG
HKR362074 RBd05D02 pGCAP10 NM_181795.1  
GCTGCTCTATTCAGCAAATGTGCAAATGGATGCTGCAGGACCGTAACAGTAGACATTGAT
HKR363327 RBd08F07 pGCAP10 NM_181795.1  
GGGTGGTTAACGCACAAGTAGGATAAAAGAGCTCGCCCCAGGCTGCCAGCAGAAAAAAGC
HKR394858 RBd87C10 pGCAP10 NM_181795.1  
GACGTACCTGGTGGAGCGGGCGCGTGAGTGGGTGTCCCTATGCGAGGAGGGAGGAGTGGG
HKR408989 RBdS022H21 pGCAP10 NM_181795.1  
GAGACGCGGCCGCATCCCGGTGGACTGTAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCA
HKR441977 RBdS104P17 pGCAP10 NM_181795.1  
GAGACGCGGCCGCATCCCGGTGGACTGTAGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl