Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05214

HP ID(1) HP05214
Gene ID(2) 10244
Gene Symbol finder RABEPK
Protein Name Rab9 effector protein with kelch motifs
RefSeq NM_005833.2
Length of RefSeq (bp) 1530
Chromosome 9q33.3
Reference DDBJ accession
UniGene Hs.19012

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe64F03 pKA1U5 GAGTCACGGCTCGCGACTGGCCTAAGTCGCCGCAGAACTGCCACGTGGGGATGAGATTTG
ARiS045K05 pGCAP10 GGGAGTCACGGCTCGCGACTGGCCTAAGTCGCCGCAGAACTGCCACGTGGGGATGAGATT
RBb04C05 pKA1U5 GACGGCTCGCGACTGGCCTAAGTCGCCGCAGAACTGCCACGNTGGGGATGAGATTTGCTG
RBb30D08 pGCAP1 TTGTGGTCGCGACTGGCCTAAGTCGCCGCAGAACTGCCACGTGGGGATGAGATTTGCTGG
RBb42D03 pGCAP1 GGCCGCAGGTATTGCAGTCCGGGGCTGGAGGGTAGGGGCGAGGGTCCCCGGATACCGGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl