Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05213

HP ID(1) HP05213
Gene ID(2) 5881
Gene Symbol finder RAC3
Protein Name ras-related C3 botulinum toxin substrate 3 (rhofamily, small GTP binding protein Rac3)
RefSeq NM_005052.2
Length of RefSeq (bp) 1077
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.45002

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi57F12 pGCAP10 GGGGCATTTCTCCGCAGCTCGGCTCGCGGCCGCGCCCGCCGCCGCCCGGCCCGCGCCCAT
RBb04C03 pKA1U5 ATTTCTCCGCAGCTCGGCTCGCGGCCGCGCCCGCCGCCGCCCGGCCCGCGCCCATGCAGG
RBb26B10 pGCAP1 TGCTGTCTCCGGCCGATTGCTCGGCGCTCGGGTCCGCGGCCGCTGCGGCGCCGGGCATTT
RBdS014E24 pGCAP10 GGTCTCCGGCCGATTGCTCGGCGCTCGGGTCCGCGGCCGCTGCGGCGCCGGGCATTTCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl