Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05202

HP ID(1) HP05202
Gene ID(2) 10081
Gene Symbol finder PDCD7
Protein Name programmed cell death 7
RefSeq NM_005707.1
Length of RefSeq (bp) 2866
Chromosome 15q22.31
Reference DDBJ accession
UniGene Hs.458596

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb03E04 pKA1U5 GATGGCCCTGCCACCATTCTTCGGCCAGGGATCGCCCAGGCCCACCGCCCCCGCAGCCGC
RBb19A01 pKA1U5 GAAAAGCATCTCCGCTCGTGAACATGGCCCTGCCACCATTTCTTCGGCCAGGGNTCGCCC
RBd01F01 pGCAP10
RBd98G07 pGCAP10 TGACTTCTCAAAGCATCTCCGTCGTGAACATGGCCCTGCCACCATTCTTCGGCCAGGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl