Prev. | 

RIKEN DNA Bank Human Resource - PDCD7

Gene ID NCBI Gene 10081 |  KEGG hsa:10081
Gene Symbol PDCD7
Protein Name programmed cell death 7
Synonyms ES18|HES18
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010929 IRAK027F09 pCMV-SPORT6 BC016992 NM_005707 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR321300 RBb03E04 pKA1U5 NM_005707.1  
GATGGCCCTGCCACCATTCTTCGGCCAGGGATCGCCCAGGCCCACCGCCCCCGCAGCCGC
HKR327601 RBb19A01 pKA1U5 NM_005707.1  
GAAAAGCATCTCCGCTCGTGAACATGGCCCTGCCACCATTTCTTCGGCCAGGGNTCGCCC
HKR360521 RBd01F01 pGCAP10 NM_005707.1  
HKR399351 RBd98G07 pGCAP10 NM_005707.1  
TGACTTCTCAAAGCATCTCCGTCGTGAACATGGCCCTGCCACCATTCTTCGGCCAGGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl