Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05194

HP ID(1) HP05194
Gene ID(2) 4731
Gene Symbol finder NDUFV3
Protein Name NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
RefSeq NM_021075.3
Length of RefSeq (bp) 2151
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.473937

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi22G08 pGCAP10 TGTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGC
RBb02H04 pKA1U5 ATCCTGGGCTTGGTGCGCCCGCTGTCACCGCCATGGNTGCCCCGNTGTTTGCTGCGGCAA
RBd49G01 pGCAP10 GTTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGC
RBd74E10 pGCAP10 GGTTCAGGCGCGGGTGCGCGCGCAGCTGCTGTGGCCCTGCTTGGTGCGCCCGCTGTCACC
RBdS007O10 pGCAP10 GGCGCGCAGCTGCTGTGGCCCTGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGT
RBdS075K23 pGCAP10 GGCGCAGCTGCTGTGGCCCTGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGT
RBdS081B17 pGCAP10 GGTGGCCCTGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCA
RBdS110N08 pGCAP10 GTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGCC
RBdS156G22 pGCAP10 GGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl