Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFV3

Gene ID (NCBI) 4731
Gene Symbol NDUFV3
Protein Name NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
Synonyms CI-10k|CI-9KD
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087117 IRAL017N05 pOTB7 BC021217 NM_021075 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR168952 ARi22G08 pGCAP10 NM_021075.3
TGTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGC
HKR320972 RBb02H04 pKA1U5 NM_021075.3
ATCCTGGGCTTGGTGCGCCCGCTGTCACCGCCATGGNTGCCCCGNTGTTTGCTGCGGCAA
HKR379745 RBd49G01 pGCAP10 NM_021075.3
GTTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGC
HKR389706 RBd74E10 pGCAP10 NM_021075.3
GGTTCAGGCGCGGGTGCGCGCGCAGCTGCTGTGGCCCTGCTTGGTGCGCCCGCTGTCACC
HKR403146 RBdS007O10 pGCAP10 NM_021075.3
GGCGCGCAGCTGCTGTGGCCCTGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGT
HKR430263 RBdS075K23 pGCAP10 NM_021075.3
GGCGCAGCTGCTGTGGCCCTGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGT
HKR432441 RBdS081B17 pGCAP10 NM_021075.3
GGTGGCCCTGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCA
HKR444320 RBdS110N08 pGCAP10 NM_021075.3
GTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGCC
HKR462566 RBdS156G22 pGCAP10 NM_021075.3
GGCTTGGTGCGCCCGCTGTCACCGCCATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl