Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05192

HP ID(1) HP05192
Gene ID(2) 55813
Gene Symbol finder UTP6
Protein Name UTP6, small subunit (SSU) processome component, homolog (yeast)
RefSeq NM_018428.2
Length of RefSeq (bp) 2065
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.589862

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb02F10 pKA1U5 GAGGGCTGGGTCTCCGAACCTGAAACCGGGAGCTTCCTGCTCGTGTTCGCTGTTGAGAAG
RBd44G04 pGCAP10 GACGCGTCGGTGGTAGGGCTGGGTCTCCGAACCTGAAACCGGGAGCTTCCTGCTCGTGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl