Prev. |  KEGG KO K14557 > 

RIKEN DNA Bank Human Resource - UTP6

Gene ID NCBI Gene 55813 |  KEGG hsa:55813
Gene Symbol UTP6
Protein Name UTP6 small subunit processome component
Synonyms C17orf40|HCA66
Ortholog resources KEGG ortholog (KEGG orthology K14557) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011117 IRAK027N05 pCMV-SPORT6 BC015454 NM_018428 Partial
HGX020194 IRAK050I02 pCMV-SPORT6 BC035325 NM_018428 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320930 RBb02F10 pKA1U5 NM_018428.2  
GAGGGCTGGGTCTCCGAACCTGAAACCGGGAGCTTCCTGCTCGTGTTCGCTGTTGAGAAG
HKR377748 RBd44G04 pGCAP10 NM_018428.2  
GACGCGTCGGTGGTAGGGCTGGGTCTCCGAACCTGAAACCGGGAGCTTCCTGCTCGTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl