Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05181

HP ID(1) HP05181
Gene ID(2) 55257
Gene Symbol finder C20orf20
Protein Name chromosome 20 open reading frame 20
RefSeq NM_018270.3
Length of RefSeq (bp) 1685
Chromosome 20q13.33
Reference DDBJ accession
UniGene Hs.590870

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb02B11 pKA1U5 GGCTCGGCCGGGCCGCGGCCATGGGAGAGGCCGAGGTGGGCGGCGGGGGCGCCGCAGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl