Prev. |  KEGG KO K11343 > 

RIKEN DNA Bank Human Resource - MRGBP

Gene ID NCBI Gene 55257 |  KEGG hsa:55257
Gene Symbol MRGBP
Protein Name MRG domain binding protein
Synonyms C20orf20|Eaf7|MRG15BP|URCC4
Ortholog resource in our bank

  MRGBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081941 IRAL004O05 pOTB7 BC018841 NM_018270 Full
HGY090326 IRAL025N14 pOTB7 BC009889 NM_018270
HGY092182 IRAL030H14 pOTB7 BC014235 NM_018270 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036524 W01A091F04 pENTR-TOPO flj0036m07 AK001776 NM_018270  
HGE036532 W01A091F12 pENTR-TOPO flj0036m07 AK001776 NM_018270  
HGE036536 W01A091F16 pENTR-TOPO flj0036m07 AK001776 NM_018270  
HGE036542 W01A091F22 pENTR-TOPO flj0036m07 AK001776 NM_018270  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320835 RBb02B11 pKA1U5 NM_018270.3  
GGCTCGGCCGGGCCGCGGCCATGGGAGAGGCCGAGGTGGGCGGCGGGGGCGCCGCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl