Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05175

HP ID(1) HP05175
Gene ID(2) 10914
Gene Symbol finder PAPOLA
Protein Name poly(A) polymerase alpha
RefSeq NM_032632.3
Length of RefSeq (bp) 4539
Chromosome 14q32.31
Reference DDBJ accession
UniGene Hs.719187

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe72B03 pKA1U5 GCGGGCGCCATGTTAGGACGAAGGGGAAGGAGGAGAAGCGCTTAAAGCGGCGGGAGCGGT
RBb01H03 pKA1U5 GGCTTAAAGCGGCGGGAGCGGTGCGGGAGAGGGGTTGGACCCAGGGCTGAGGCAGGCCCC
RBd43E01 pGCAP10 CGGCCGGCCGATGAACGTTGCTGTGGTAGCGCTCGGGCGCCATGTTAGGACGAAGGGGAA
RBdS013G24 pGCAP10 GAGTTCTAGAACGTTGCTGTGGTAGCGCTCGGGCGCCATGTTAGGACGAAGGGGAAGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl