Prev. |  KEGG KO K14376 > 

RIKEN DNA Bank Human Resource - PAPOLA

Gene ID NCBI Gene 10914 |  KEGG hsa:10914
Gene Symbol PAPOLA
Protein Name poly(A) polymerase alpha
Synonyms PAP|PAP-alpha
Ortholog resource in our bank

  PAPOLA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019255 IRAK048C07 pBluescriptR BC036014 NM_032632 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068827 ARe72B03 pKA1U5 NM_032632.3  
GCGGGCGCCATGTTAGGACGAAGGGGAAGGAGGAGAAGCGCTTAAAGCGGCGGGAGCGGT
HKR320571 RBb01H03 pKA1U5 NM_032632.3  
GGCTTAAAGCGGCGGGAGCGGTGCGGGAGAGGGGTTGGACCCAGGGCTGAGGCAGGCCCC
HKR377297 RBd43E01 pGCAP10 NM_032632.3  
CGGCCGGCCGATGAACGTTGCTGTGGTAGCGCTCGGGCGCCATGTTAGGACGAAGGGGAA
HKR405368 RBdS013G24 pGCAP10 NM_032632.3  
GAGTTCTAGAACGTTGCTGTGGTAGCGCTCGGGCGCCATGTTAGGACGAAGGGGAAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl