Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05160

HP ID(1) HP05160
Gene ID(2) 55848
Gene Symbol finder C9orf46
Protein Name chromosome 9 open reading frame 46
RefSeq NM_018465.2
Length of RefSeq (bp) 926
Chromosome 9p24.1
Reference DDBJ accession
UniGene Hs.584242

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39E01 pKA1U5 GAGCGGGCGAAAGGAGCCCGGGCCTGGAGGTTTGCGTACCGGTCGCCTGGTCCCGGCACC
ARiS013L11 pGCAP10 TTTCGGGAGGTGCGNCCTCTTCTGTGTCTGGGCGCCAATCCCGACGCTGGGCGGAGCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl