Prev. | 

RIKEN DNA Bank Human Resource - PLGRKT

Gene ID NCBI Gene 55848 |  KEGG hsa:55848
Gene Symbol PLGRKT
Protein Name plasminogen receptor with a C-terminal lysine
Synonyms AD025|C9orf46|MDS030|PLG-RKT|Plg-R(KT)
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005461 IRAK013K21 pCMV-SPORT6 BC008212 NM_018465 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055697 ARe39E01 pKA1U5 NM_018465.2  
GAGCGGGCGAAAGGAGCCCGGGCCTGGAGGTTTGCGTACCGGTCGCCTGGTCCCGGCACC
HKR205475 ARiS013L11 pGCAP10 NM_018465.2  
TTTCGGGAGGTGCGNCCTCTTCTGTGTCTGGGCGCCAATCCCGACGCTGGGCGGAGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl