Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05150

HP ID(1) HP05150
Gene ID(2) 23207
Gene Symbol finder PLEKHM2
Protein Name pleckstrin homology domain containing, family M (with RUN domain) member 2
RefSeq NM_015164.1
Length of RefSeq (bp) 4231
Chromosome 1p36.21
Reference DDBJ accession
UniGene Hs.646775

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe38F07 pKA1U5 GCCCCGCCGGCCGCGCTCCGGAGCCTCCGGGCCACNTATGGAGCGAGGGCCCAGGCGAGG
RBb60D08 pGCAP1 GCCCCCGGCGCGGGAAGCGGCGGCGGGGCGGCGGCGGCGGTGGCGGTGGCGGTGGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl