DNA Bank Top |  KEGG KO K15348 > 

RIKEN DNA Bank Human Resource - PLEKHM2

Gene ID NCBI Gene 23207 |  KEGG hsa:23207
Gene Symbol PLEKHM2
Protein Name pleckstrin homology and RUN domain containing M2
Synonyms SKIP

Link

Ortholog resource in our bank

  PLEKHM2

External database

human PLEKHM2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB13233 pmStr-C1-SKIP/PLEKHM2 Expression vector of SKIP/PLEKHM2    
RDB13232 pEGFP-C1-SKIP/PLEKHM2 Expression vector of SKIP/PLEKHM2    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010776 IRAK026P16 pCMV-SPORT6 BC016488 XM_938581 Partial
HGX035242 IRAK088B18 pCMV-SPORT6 BC042103 XM_938581 Partial
HGY067044 IRAK167K04 pBluescriptR BC068599 XM_938581 Partial/var
HGX033800 IRAK084I08 pCMV-SPORT6 BC040441 XM_938581 Partial/var
HGX025672 IRAK064C24 pCMV-SPORT6 BC030545 XM_938581 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055327 ARe38F07 pKA1U5 NM_015164.1  
GCCCCGCCGGCCGCGCTCCGGAGCCTCCGGGCCACNTATGGAGCGAGGGCCCAGGCGAGG
HKR344080 RBb60D08 pGCAP1 NM_015164.1  
GCCCCCGGCGCGGGAAGCGGCGGCGGGGCGGCGGCGGCGGTGGCGGTGGCGGTGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl