Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05141

HP ID(1) HP05141
Gene ID(2) 49856
Gene Symbol finder WDR8
Protein Name WD repeat domain 8
RefSeq NM_017818.2
Length of RefSeq (bp) 1675
Chromosome 1p36.3
Reference DDBJ accession
UniGene Hs.31714

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe37H01 pKA1U5 GGCGCCCAGGGGTCCCGCGGGTTTTCGGGCGCNGGNNTGGCGCCCGCGGCAGGCGGCGGC
RBd38E05 pGCAP10 GGCTGTTGTGCTCGCCCAGGGGTCCCACGGGTTTTCGGGCGCAGGGTGGCGCCCGCGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl