Prev. | 

RIKEN DNA Bank Human Resource - WRAP73

Gene ID NCBI Gene 49856 |  KEGG hsa:49856
Gene Symbol WRAP73
Protein Name WD repeat containing, antisense to TP73
Synonyms WDR8
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054969 ARe37H01 pKA1U5 NM_017818.2  
GGCGCCCAGGGGTCCCGCGGGTTTTCGGGCGCNGGNNTGGCGCCCGCGGCAGGCGGCGGC
HKR375301 RBd38E05 pGCAP10 NM_017818.2  
GGCTGTTGTGCTCGCCCAGGGGTCCCACGGGTTTTCGGGCGCAGGGTGGCGCCCGCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl