Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05135

HP ID(1) HP05135
Gene ID(2) 81565
Gene Symbol finder NDEL1
Protein Name nudE nuclear distribution gene E homolog (A. nidulans)-like 1
RefSeq NM_030808.3
Length of RefSeq (bp) 1385
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.372123

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe37F06 pKA1U5 GAGGGGAGACGTCGGTTGAGCGGCGGCGAACACGCNTCTTTTGACACATTGGAGGCTTTC
ARiS045K15 pGCAP10 GGTGTCGGGGAGGAGCCGGGCGCGGAGGTACGCTGAGTGGAGCTCGGGGCTGCGTAGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl