Prev. |  KEGG KO K16739 > 

RIKEN DNA Bank Human Resource - NDEL1

Gene ID NCBI Gene 81565 |  KEGG hsa:81565
Gene Symbol NDEL1
Protein Name nudE neurodevelopment protein 1 like 1
Synonyms EOPA|MITAP1|NDE1L1|NDE2|NUDEL
Ortholog resource in our bank

  NDEL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018578 IRAK046H10 pBluescriptR BC026101 NM_030808 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054926 ARe37F06 pKA1U5 NM_030808.3  
GAGGGGAGACGTCGGTTGAGCGGCGGCGAACACGCNTCTTTTGACACATTGGAGGCTTTC
HKR218255 ARiS045K15 pGCAP10 NM_030808.3  
GGTGTCGGGGAGGAGCCGGGCGCGGAGGTACGCTGAGTGGAGCTCGGGGCTGCGTAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl