Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05133

HP ID(1) HP05133
Gene ID(2) 65062
Gene Symbol finder ALS2CR4
Protein Name amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4
RefSeq NM_152388.2
Length of RefSeq (bp) 5335
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.12319

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe37C03 pKA1U5 GGGCTCAGGGGGCGGCTGCCTCGCCAGGCGCCACGAAGCCCCGGCGTCCCACAGGTCCCG
ARi12A04 pGCAP10 CGGCCGGCCGATGAGGGGGCGGCTGCCTCGCCAGGCGCCACGAAGCCCCGGCGTCCCACA
RBb64H11 pGCAP1 GGAGCCGGGAGGGGTGGGGCGCCAGGTGCTTGGGGGCCGGCGGCCGCCGAGGCCGGCTAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl