Prev. | 

RIKEN DNA Bank Human Resource - TMEM237

Gene ID NCBI Gene 65062 |  KEGG hsa:65062
Gene Symbol TMEM237
Protein Name transmembrane protein 237
Synonyms ALS2CR4|JBTS14
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008530 IRAK021F10 pCMV-SPORT6 BC013730 NM_152388 Partial
HGY025574 IRAK063P14 pBluescriptR BC029611 NM_152388 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054851 ARe37C03 pKA1U5 NM_152388.2  
GGGCTCAGGGGGCGGCTGCCTCGCCAGGCGCCACGAAGCCCCGGCGTCCCACAGGTCCCG
HKR164804 ARi12A04 pGCAP10 NM_152388.2  
CGGCCGGCCGATGAGGGGGCGGCTGCCTCGCCAGGCGCCACGAAGCCCCGGCGTCCCACA
HKR345779 RBb64H11 pGCAP1 NM_152388.2 done
GGAGCCGGGAGGGGTGGGGCGCCAGGTGCTTGGGGGCCGGCGGCCGCCGAGGCCGGCTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl