Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05131

HP ID(1) HP05131
Gene ID(2) 23705
Gene Symbol finder CADM1
Protein Name cell adhesion molecule 1
RefSeq NM_014333.3
Length of RefSeq (bp) 4324
Chromosome 11q23.2
Reference DDBJ accession
UniGene Hs.370510

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe37B12 pKA1U5 GAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGCGGATCCCAGTGTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl