Prev. |  KEGG KO K06781 > 

RIKEN DNA Bank Human Resource - CADM1

Gene ID NCBI Gene 23705 |  KEGG hsa:23705
Gene Symbol CADM1
Protein Name cell adhesion molecule 1
Synonyms BL2|IGSF4|IGSF4A|NECL2|Necl-2|RA175|ST17|SYNCAM|TSLC1|sTSLC-1|sgIGSF|synCAM1
Ortholog resources KEGG ortholog (KEGG orthology K06781) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094808 IRAL037A08 pDNR-LIB BC035930 NM_014333 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054836 ARe37B12 pKA1U5 NM_014333.3  
GAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGCGGATCCCAGTGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl