Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05128

HP ID(1) HP05128
Gene ID(2) 11012
Gene Symbol finder KLK11
Protein Name kallikrein-related peptidase 11
RefSeq NM_006853.2
Length of RefSeq (bp) 1207
Chromosome 19q13.3-q13.4
Reference DDBJ accession
UniGene Hs.57771

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe36H10 pKA1U5 ACCTGGCGCTCCAACCCAGCCTACCTGCTGTAGCTGNCGCCACTGCCGTCTCCGCCGCCA
ARiS118M14 pGCAP10 GCCGCCCCCCTGCCAGCCCGCCTGCCTGGTGCCTGGCACCTGGCGCTCCAACCCAGCCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl