Prev. |  KEGG KO K09620 > 

RIKEN DNA Bank Human Resource - KLK11

Gene ID NCBI Gene 11012 |  KEGG hsa:11012
Gene Symbol KLK11
Protein Name kallikrein related peptidase 11
Synonyms PRSS20|TLSP
Ortholog resources KEGG ortholog (KEGG orthology K09620) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018694 IRAK046M06 pBluescriptR BC022068 NM_006853 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054578 ARe36H10 pKA1U5 NM_006853.2  
ACCTGGCGCTCCAACCCAGCCTACCTGCTGTAGCTGNCGCCACTGCCGTCTCCGCCGCCA
HKR247502 ARiS118M14 pGCAP10 NM_006853.2  
GCCGCCCCCCTGCCAGCCCGCCTGCCTGGTGCCTGGCACCTGGCGCTCCAACCCAGCCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl