Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05120

HP ID(1) HP05120
Gene ID(2) 51501
Gene Symbol finder C11orf73
Protein Name chromosome 11 open reading frame 73
RefSeq NM_016401.3
Length of RefSeq (bp) 1187
Chromosome 11q14.2
Reference DDBJ accession
UniGene Hs.283322

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe36A07 pKA1U5 GATTCTTGCCGCTGGCCCAGTCACTATGTAGTGGAGGGGCAGACACCCTCCCGCAAATTC
ARe68G11 pKA1U5 GATTCTTGCCGCTGGCCCAGTCACTATGTAGTGGAGGGGCAGACACCCTCCCGCAAATTC
RBdS104D16 pGCAP10 GGGAAGGTTCTTAGTCTCGACTAGGGCAGTAGCCCCAGGACTCCTAGTCGCCGGCTTCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl