Prev. | 

RIKEN DNA Bank Human Resource - HIKESHI

Gene ID NCBI Gene 51501 |  KEGG hsa:51501
Gene Symbol HIKESHI
Protein Name Hikeshi, heat shock protein nuclear import factor
Synonyms C11orf73|HLD13|HSPC138|HSPC179|L7RN6|OPI10
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012966 IRAK032G22 pBluescriptR BC018080 NM_016401 Full/var
HGY080911 IRAL002E15 pOTB7 BC015991 NM_016401 Full
HGY081103 IRAL002M15 pOTB7 BC001677 NM_016401 Full
HGY083621 IRAL009A21 pOTB7 BC021621 NM_016401
HGY083767 IRAL009G23 pOTB7 BC006476 NM_016401 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054407 ARe36A07 pKA1U5 NM_016401.3  
GATTCTTGCCGCTGGCCCAGTCACTATGTAGTGGAGGGGCAGACACCCTCCCGCAAATTC
HKR067355 ARe68G11 pKA1U5 NM_016401.3  
GATTCTTGCCGCTGGCCCAGTCACTATGTAGTGGAGGGGCAGACACCCTCCCGCAAATTC
HKR441688 RBdS104D16 pGCAP10 NM_016401.3  
GGGAAGGTTCTTAGTCTCGACTAGGGCAGTAGCCCCAGGACTCCTAGTCGCCGGCTTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl