Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05116

HP ID(1) HP05116
Gene ID(2) 3836
Gene Symbol finder KPNA1
Protein Name karyopherin alpha 1 (importin alpha 5)
RefSeq NM_002264.3
Length of RefSeq (bp) 6889
Chromosome 3q21
Reference DDBJ accession
UniGene Hs.161008

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe35H03 pKA1U5 GCTCGCTGCTCGGTGCGAGGCGGCGGAGAGCGAGGCCTGGTGAGCACCGCCGAGGCGCGG
ARi08C10 pGCAP10 GGGAGAGCGAGGCCTGGTGAGCACCGCCGAGGCGCGGGCCAGCTCTTCGAGGTTGTGCGC
ARi35E09 pGCAP10 GACTGCGAACGCCGGCTGAGCTGAGTCTCGCTGCTCGGTGCGAGGCGGCGGAGAGCGAGG
RBdS013D06 pGCAP10 GAGGGCGCACTGCGNNCNCCGGCTGAGCTGAGTCTCGCTGCTCGGTGCGAGGCGGCGGAG
RBdS110F11 pGCAP10 CGGCCGGCCGATGAGGCGCACTGCGAACGCCGGCTGAGCTGAGTCTCGCTGCTCGGTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl