Prev. |  KEGG KO K15042 > 

RIKEN DNA Bank Human Resource - KPNA1

Gene ID NCBI Gene 3836 |  KEGG hsa:3836
Gene Symbol KPNA1
Protein Name karyopherin subunit alpha 1
Synonyms IPOA5|NPI-1|RCH2|SRP1
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  KPNA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080633 IRAL001J17 pOTB7 BC002374 NM_002264 Full
HGY083743 IRAL009F23 pOTB7 BC003009 NM_002264 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054171 ARe35H03 pKA1U5 NM_002264.3  
GCTCGCTGCTCGGTGCGAGGCGGCGGAGAGCGAGGCCTGGTGAGCACCGCCGAGGCGCGG
HKR163258 ARi08C10 pGCAP10 NM_002264.3  
GGGAGAGCGAGGCCTGGTGAGCACCGCCGAGGCGCGGGCCAGCTCTTCGAGGTTGTGCGC
HKR174105 ARi35E09 pGCAP10 NM_002264.3  
GACTGCGAACGCCGGCTGAGCTGAGTCTCGCTGCTCGGTGCGAGGCGGCGGAGAGCGAGG
HKR405278 RBdS013D06 pGCAP10 NM_002264.3  
GAGGGCGCACTGCGNNCNCCGGCTGAGCTGAGTCTCGCTGCTCGGTGCGAGGCGGCGGAG
HKR444131 RBdS110F11 pGCAP10 NM_002264.3  
CGGCCGGCCGATGAGGCGCACTGCGAACGCCGGCTGAGCTGAGTCTCGCTGCTCGGTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl