Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05110

HP ID(1) HP05110
Gene ID(2) 10897
Gene Symbol finder YIF1A
Protein Name Yip1 interacting factor homolog A (S. cerevisiae)
RefSeq NM_020470.2
Length of RefSeq (bp) 1138
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.446445

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe24E08 pKA1U5 GGGACATGGTGGCCGAGACCGGCGGGGTGGGGGACGTGTCGCGCGGCCGGGTGGCCTCGG
ARe35C06 pKA1U5 GACGGACATGGCTGGCCGAGACCGGCGGGGTGGGGGACGTGTCGCGCGGCCGGGTGGCCT
ARiS055J16 pGCAP10 GGGACATGGTGGCCGAGACCGGCGGGGTGGGGGACGTGTCGCGCGGCCGGGTGGCCTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl