Prev. |  KEGG KO K20362 > 

RIKEN DNA Bank Human Resource - YIF1A

Gene ID NCBI Gene 10897 |  KEGG hsa:10897
Gene Symbol YIF1A
Protein Name Yip1 interacting factor homolog A, membrane trafficking protein
Synonyms 54TM|FinGER7|YIF1|YIF1P
Ortholog resource in our bank

  YIF1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001793 IRAK004I01 pCMV-SPORT6 BC001299 NM_020470 Full/var
HGY090378 IRAL025P18 pOTB7 BC009892 NM_020470 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049704 ARe24E08 pKA1U5 NM_020470.2  
GGGACATGGTGGCCGAGACCGGCGGGGTGGGGGACGTGTCGCGCGGCCGGGTGGCCTCGG
HKR054054 ARe35C06 pKA1U5 NM_020470.2  
GACGGACATGGCTGGCCGAGACCGGCGGGGTGGGGGACGTGTCGCGCGGCCGGGTGGCCT
HKR222232 ARiS055J16 pGCAP10 NM_020470.2  
GGGACATGGTGGCCGAGACCGGCGGGGTGGGGGACGTGTCGCGCGGCCGGGTGGCCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl