Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05103

HP ID(1) HP05103
Gene ID(2) 10769
Gene Symbol finder PLK2
Protein Name polo-like kinase 2 (Drosophila)
RefSeq NM_006622.2
Length of RefSeq (bp) 2795
Chromosome 5q12.1-q13.2
Reference DDBJ accession
UniGene Hs.398157

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34H01 pKA1U5 GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
ARe68C11 pKA1U5 GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
ARe69C11 pKA1U5 GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
ARe94D08 pKA1U5 GGCACAAGATGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGAC
ARi09G02 pGCAP10 GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
ARi17G04 pGCAP10 GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
ARi61G06 pGCAP10 GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
ARiS122A02 pGCAP10 GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
ARiS161M23 pGCAP10 TGGCGGCNCNAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAG
ARiS191M21 pGCAP10 CGGCCGGCCGATGGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAG
ARiS194D06 pGCAP10 GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
RBb62B11 pGCAP1

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl