Prev. |  KEGG KO K08861 > 

RIKEN DNA Bank Human Resource - PLK2

Gene ID NCBI Gene 10769 |  KEGG hsa:10769
Gene Symbol PLK2
Protein Name polo like kinase 2
Synonyms SNK|hPlk2|hSNK
Ortholog resources KEGG ortholog (KEGG orthology K08861) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085873 IRAL014L09 pOTB7 BC013879 NM_006622 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008180 W01A020H12 pENTR-TOPO IRAL014L09 BC013879 NM_006622  
HGE008184 W01A020H16 pENTR-TOPO IRAL014L09 BC013879 NM_006622  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053769 ARe34H01 pKA1U5 NM_006622.2  
GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
HKR067259 ARe68C11 pKA1U5 NM_006622.2  
GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
HKR067659 ARe69C11 pKA1U5 NM_006622.2  
GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
HKR077680 ARe94D08 pKA1U5 NM_006622.2  
GGCACAAGATGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGAC
HKR163746 ARi09G02 pGCAP10 NM_006622.2  
GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
HKR166948 ARi17G04 pGCAP10 NM_006622.2  
GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
HKR184550 ARi61G06 pGCAP10 NM_006622.2  
GACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACCAC
HKR248802 ARiS122A02 pGCAP10 NM_006622.2  
GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
HKR264711 ARiS161M23 pGCAP10 NM_006622.2  
TGGCGGCNCNAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAG
HKR276709 ARiS191M21 pGCAP10 NM_006622.2  
CGGCCGGCCGATGGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAG
HKR277678 ARiS194D06 pGCAP10 NM_006622.2  
GGCACAAGTGGACCGGGGTGTTGGGTGCTAGTCGGCACCAGAGGCAAGGGTGCGAGGACC
HKR344835 RBb62B11 pGCAP1 NM_006622.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl