Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05098

HP ID(1) HP05098
Gene ID(2) 7277
Gene Symbol finder TUBA4A
Protein Name tubulin, alpha 4a
RefSeq NM_006000.1
Length of RefSeq (bp) 1514
Chromosome 2q35
Reference DDBJ accession
UniGene Hs.75318

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34F10 pKA1U5 GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGNTGTAGACGCACCGCCCGGACTCAC
ARe80F04 pKA1U5 TGGCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCA
ARiS008O03 pGCAP10 GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
ARiS020G03 pGCAP10 GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
ARiS049K13 pGCAP10 TCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACC
ARiS109P04 pGCAP10 GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
ARiS118J04 pGCAP10 GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
RBd24C11 pGCAP10 GGCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCAC
RBd25E10 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBd27E06 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd27H03 pGCAP10 TGGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBd28E03 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd39E08 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd43B05 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBd43E08 pGCAP10 GTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
RBd47D04 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS007M12 pGCAP10 GGCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl