Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TUBA4A

Gene ID (NCBI) 7277
Gene Symbol TUBA4A
Protein Name tubulin alpha 4a
Synonyms ALS22|H2-ALPHA|TUBA1
Databases KEGG hsa:7277 |  NCBI Gene 7277
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07374)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081145 IRAL002O09 pOTB7 BC009238 NM_006000 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053730 ARe34F10 pKA1U5 NM_006000.1  
GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGNTGTAGACGCACCGCCCGGACTCAC
HKR072124 ARe80F04 pKA1U5 NM_006000.1  
TGGCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCA
HKR203539 ARiS008O03 pGCAP10 NM_006000.1  
GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
HKR208147 ARiS020G03 pGCAP10 NM_006000.1  
GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
HKR219853 ARiS049K13 pGCAP10 NM_006000.1  
TCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACC
HKR243964 ARiS109P04 pGCAP10 NM_006000.1  
GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
HKR247420 ARiS118J04 pGCAP10 NM_006000.1  
GAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCA
HKR369659 RBd24C11 pGCAP10 NM_006000.1  
GGCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCAC
HKR370106 RBd25E10 pGCAP10 NM_006000.1  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR370902 RBd27E06 pGCAP10 NM_006000.1  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR370971 RBd27H03 pGCAP10 NM_006000.1  
TGGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR371299 RBd28E03 pGCAP10 NM_006000.1  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR375704 RBd39E08 pGCAP10 NM_006000.1  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR377229 RBd43B05 pGCAP10 NM_006000.1  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR377304 RBd43E08 pGCAP10 NM_006000.1  
GTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
HKR378876 RBd47D04 pGCAP10 NM_006000.1  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR403100 RBdS007M12 pGCAP10 NM_006000.1  
GGCAGTTCTCACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl