Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05097

HP ID(1) HP05097
Gene ID(2) 200185
Gene Symbol finder KRTCAP2
Protein Name keratinocyte associated protein 2
RefSeq NM_173852.3
Length of RefSeq (bp) 577
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.516671

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34E11 pKA1U5 GGCATGCGCATAGCTAACCGCACCCGGTTCAGCTCGNCTTTCTTGGCCAGAGGCGCCGGT
ARiS096E23 pGCAP10 GACCCGGTTCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCAT
RBb59F05 pGCAP1 TTTTGTCCCGACTGCCCCTTATCTACTCTGGACGGGGTGGAAAATAAAGGGGTACGGGCA
RBd01A04 pGCAP10 GGGGGCATGATGGGTAACAGGACCGTGGTGGGTACGGGCACCTCGCTGGCGCTCTCCTCC
RBd21D11 pGCAP10 GAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGGTGGGTACGGGCACCTCGCT
RBdS081K14 pGCAP10 GGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGGTGGGTACGGGCACCTC
RBdS177N08 pGCAP10 GGGTTCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl