Prev. | 

RIKEN DNA Bank Human Resource - KRTCAP2

Gene ID NCBI Gene 200185 |  KEGG hsa:200185
Gene Symbol KRTCAP2
Protein Name keratinocyte associated protein 2
Synonyms KCP2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020238 IRAK050J22 pCMV-SPORT6 BC029806 NM_173852 Full
HGY097696 IRAL044D24 pOTB7 BC048205 NM_173852 Partial
HGY099409 IRAL048I17 pDNR-LIB BC057233 NM_173852 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE093202 M01C033A02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093250 M01C033C02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093298 M01C033E02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093346 M01C033G02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093394 M01C033I02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093442 M01C033K02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093490 M01C033M02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093538 M01C033O02 pDONR221 MGC06-B01 BC029806 NM_173852  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053707 ARe34E11 pKA1U5 NM_173852.3  
GGCATGCGCATAGCTAACCGCACCCGGTTCAGCTCGNCTTTCTTGGCCAGAGGCGCCGGT
HKR238519 ARiS096E23 pGCAP10 NM_173852.3  
GACCCGGTTCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCAT
HKR343725 RBb59F05 pGCAP1 NM_173852.3  
TTTTGTCCCGACTGCCCCTTATCTACTCTGGACGGGGTGGAAAATAAAGGGGTACGGGCA
HKR360404 RBd01A04 pGCAP10 NM_173852.3  
GGGGGCATGATGGGTAACAGGACCGTGGTGGGTACGGGCACCTCGCTGGCGCTCTCCTCC
HKR368483 RBd21D11 pGCAP10 NM_173852.3  
GAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGGTGGGTACGGGCACCTCGCT
HKR432654 RBdS081K14 pGCAP10 NM_173852.3  
GGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGGTGGGTACGGGCACCTC
HKR471120 RBdS177N08 pGCAP10 NM_173852.3  
GGGTTCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl