Prev. | 

RIKEN DNA Bank Human Resource - KRTCAP2

Gene ID NCBI Gene 200185 |  KEGG hsa:200185
Gene Symbol KRTCAP2
Protein Name keratinocyte associated protein 2
Synonyms KCP2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020238 IRAK050J22 pCMV-SPORT6 BC029806 NM_173852 Full
HGY097696 IRAL044D24 pOTB7 BC048205 NM_173852 Partial
HGY099409 IRAL048I17 pDNR-LIB BC057233 NM_173852 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE093202 M01C033A02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093250 M01C033C02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093298 M01C033E02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093346 M01C033G02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093394 M01C033I02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093442 M01C033K02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093490 M01C033M02 pDONR221 MGC06-B01 BC029806 NM_173852  
HGE093538 M01C033O02 pDONR221 MGC06-B01 BC029806 NM_173852  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053707 ARe34E11 pKA1U5 NM_173852.3  
GGCATGCGCATAGCTAACCGCACCCGGTTCAGCTCGNCTTTCTTGGCCAGAGGCGCCGGT
HKR238519 ARiS096E23 pGCAP10 NM_173852.3  
GACCCGGTTCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCAT
HKR343725 RBb59F05 pGCAP1 NM_173852.3  
TTTTGTCCCGACTGCCCCTTATCTACTCTGGACGGGGTGGAAAATAAAGGGGTACGGGCA
HKR360404 RBd01A04 pGCAP10 NM_173852.3  
GGGGGCATGATGGGTAACAGGACCGTGGTGGGTACGGGCACCTCGCTGGCGCTCTCCTCC
HKR368483 RBd21D11 pGCAP10 NM_173852.3  
GAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGGTGGGTACGGGCACCTCGCT
HKR432654 RBdS081K14 pGCAP10 NM_173852.3  
GGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATGGTGGTGGGTACGGGCACCTC
HKR471120 RBdS177N08 pGCAP10 NM_173852.3  
GGGTTCAGCTCGCCTTTCTTGGCCAGAGGCGCCGGTTGGACTCACGGGCGGGGCATGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl