Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05085

HP ID(1) HP05085
Gene ID(2) 7041
Gene Symbol finder TGFB1I1
Protein Name transforming growth factor beta 1 induced transcript 1
RefSeq NM_015927.3
Length of RefSeq (bp) 1824
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.513530

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe33F10 pKA1U5 GGCGCCACCGGCCCGCGCCCCGCCATGGAGGACCTGGATGCCCTGCTCTCTGACCTGGAG
ARe68D10 pKA1U5 GGCCCCGCCATGGAGGACCTGGATGCCCTGCTCTNTGACCTGGAGACTACCACCTCGCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl