Prev. | 

RIKEN DNA Bank Human Resource - TGFB1I1

Gene ID NCBI Gene 7041 |  KEGG hsa:7041
Gene Symbol TGFB1I1
Protein Name transforming growth factor beta 1 induced transcript 1
Synonyms ARA55|HIC-5|HIC5|TSC-5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027853 IRAK069K13 pCMV-SPORT6 BC032545 NM_015927 Full
HGY081282 IRAL003D10 pOTB7 BC001507 NM_015927 Full
HGY084140 IRAL010F20 pOTB7 BC001830 NM_015927
HGY095844 IRAL039K04 pOTB7 BC017288 NM_015927 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011475 W01A028L11 pENTR-TOPO IRAL003D10 BC001830 NM_015927  
HGE011477 W01A028L13 pENTR-TOPO IRAL003D10 BC001830 NM_015927  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053330 ARe33F10 pKA1U5 NM_015927.3  
GGCGCCACCGGCCCGCGCCCCGCCATGGAGGACCTGGATGCCCTGCTCTCTGACCTGGAG
HKR067282 ARe68D10 pKA1U5 NM_015927.3  
GGCCCCGCCATGGAGGACCTGGATGCCCTGCTCTNTGACCTGGAGACTACCACCTCGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl