Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05072

HP ID(1) HP05072
Gene ID(2) 7029
Gene Symbol finder TFDP2
Protein Name transcription factor Dp-2 (E2F dimerization partner 2)
RefSeq NM_006286.3
Length of RefSeq (bp) 1313
Chromosome 3q23
Reference DDBJ accession
UniGene Hs.379018

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe32G01 pKA1U5 GGTAGCTGGGCAGGGCAGAGGGCGGACGAAATCCNCTNTCGATCTCGGCTGCGGCGCTGC
RBb45D06 pGCAP1 TGGCCAAAGCTCGCGCGGGGGAAGCGGGGCTGTAGCTGGGCAGGGAGAGGGCGGACGAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl