DNA Bank Top |  KEGG KO K09392 > 

RIKEN DNA Bank Human Resource - TFDP2

Gene ID NCBI Gene 7029 |  KEGG hsa:7029
Gene Symbol TFDP2
Protein Name transcription factor Dp-2
Synonyms DP2

Link

Ortholog resource in our bank

  TFDP2

External database

human TFDP2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07007 pCMFlag_hsTFDP2 Expression vector of human TFDP2.    
RDB05443 pAxCALNLhTFDP2 (reverse) Shuttle vector to generate rAd harboring human TFDP2 (reverse)    
RDB05442 pAxCALNLhTFDP2 (forward) Shuttle vector to generate rAd harboring human TFDP2 (forward)    
RDB04153 pAxCALNLhTFDP2 (reverse) Shuttle vector to generate rAd harboring human TFDP2    
RDB04111 pAxCALNLhTFDP2 (reverse) Shuttle vector to generate rAd harboring human TFDP2    
RDB03586 pAxCALNLhTFDP2 (forward) Shuttle vector to generate rAd harboring human TFDP2 (forward)    
RDB03535 pAxCALNLhTFDP2 (forward) Shuttle vector to generate rAd harboring human TFDP2 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091287 IRAL028D15 pOTB7 BC013993 NM_006286 Full
HGY096182 IRAL040H14 pOTB7 BC021113 NM_006286 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052945 ARe32G01 pKA1U5 NM_006286.3  
GGTAGCTGGGCAGGGCAGAGGGCGGACGAAATCCNCTNTCGATCTCGGCTGCGGCGCTGC
HKR338078 RBb45D06 pGCAP1 NM_006286.3  
TGGCCAAAGCTCGCGCGGGGGAAGCGGGGCTGTAGCTGGGCAGGGAGAGGGCGGACGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2025.03.19

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl